About Us – Research Computing

[easingslider id=”111″] Research Computing facilitates and enables the advancement of research by providing leading-edge computing services. Computational resources are available for high performance and scientific computing, bioinformatic analysis, visualization, and data storage. Research Computing continually expands its services and technologies,

[easingslider id=”101″] Research Computing GIS WordPress site Home — Resources — Services — Tools — Training — Resources Page under construction — What is GIS? Citrin Family GIS/Applied Spatial Analysis Lab Baker Library Research Guide: GIS GIS Data at Dartmouth

Research Computing ITS homepage Dartmouth Information Technology Services Knowledge-Base articles: Dartmouth ITS Knowledge Base

Life Sciences are the sciences concerned with the study of living organisms, including biology, botany, zoology, microbiology, physiology, biochemistry, and related subjects. Bioinformatics collects and analyzes complex biological data. Life Sciences / Bioinformatics Office Hours Life Sciences / Bioinformatics Contact

Under construction

Contacting Research ITC: For general enquiries, requests, or questions email Research.Computing@dartmouth.edu or help@dartmouth.edu (put Research Computing in the subject line), or call the ITC Service Desk at 603-646-2999 or toll free 1-855-764-2485. If you are requesting help with a service, filling

Note: Some Research Computing’s Office Hours are not currently taking place because our staff is working remotely. We do hope to resume these in the future. In the meantime, please feel free to email us. GIS, Spatial Data & Informatics

09/20/16, 2-4pm, “Introduction to GIS Workshop”, Instructional Center, 1st floor of 37 Dewey Field Rd, Instructor: Stephen Gaughan

Research Computing facilitates the advancement of research by providing leading-edge computing services. We are also known as Research Information, Technology and Consulting (RITC), a department within the Dartmouth College division of Information, Technology and Consulting, Computational resources are available for high

Our powerful Linux HPC cluster with GPU nodes and highspeed interconnects gives researchers the ability to work with a large volume of data and run complex, processing-intensive programs.

We offer consulting; programming and software development; and support for GIS, statistics, and more. Most of our services are available at no cost to members of the Dartmouth Community.

We provide access and support for many software and hardware resources. Create an account at dartmouth.edu/~rc/accounts to gain access to Discovery and other resources.

Longbao Cultural Map Referencing and Vectorization

Working with a hand-drawn cultural map from the Longbao region of the Tibetan Plateau, the map was georeferenced to real-world locations and features from the map were converted to vector format for use in geographic information system software.

Building on the work of Herron, Stewart, et al studying the tradeoff between election resources and voter waiting, PollTrack is a new mobile web application to collect election day information. This application greatly simplifies the process for collecting data, but

Multimedia in the Long Eighteenth Century (MMLEC) seeks to quantify the frequency with which musical paratext, including both lyrics and musical notation, appear in English- and French-language novels published between 1688 and 1815. Read more or watch a video about this

Our systems support applications for Bioinformatics, Chemistry, Mathematics, Statistics, Data Visualization and more. Take a look at our list of available applications.

Andes Andes is a shared memory computer (SMP) with 60 physical cores (120 logical cores with HyperThreading turned on), 64-bit Intel processors, and 512 GB of memory. It runs Red Hat Enterprise Linux 7 and is mostly used to run

Research Computing provides support to researchers across a wide spectrum of fields and disciplines. We have an especially extensive collection of resources, services, and experts in:

Research Computing provides support to researchers across a wide spectrum of fields and disciplines. We have an especially extensive collection of resources, services, and experts in: Global Information Systems Statistics Life

Geographic Information Systems are systems to create, store, view, edit, analyze and export data that is tied to locations on the earth’s surface. We support and provide GIS software and training, and our GIS Application Specialist can offer expert consultations and assistance. GIS has

We facilitate grant proposal writing by providing configuration and pricing for a grant’s proposed hardware and software.

We offer consulting; programming and software development; and support for GIS, statistics, and more. Most of our services are available at no cost to members of the Dartmouth Community.

Our powerful Linux HPC cluster with GPU nodes and highspeed interconnects gives researchers the ability to work with a large volume of data and run complex, processing-intensive programs.

Here you will will find help with accessing and using the resources we provide the Dartmouth Community. As always, feel free to email Research.Computing@dartmouth.edu with questions or requests, or if you don’t find what you are looking for here. FAQs

ITC in collaboration with the Dartmouth Library (ITCxLibrary) helps you learn Reproducible Research principle, file and data management, scripting and programming tool, and more, as well as how to use research software and systems through our live training sessions and

Discovery is a 3000+ core Linux cluster that is available to the Dartmouth research community. Discovery contains ‘C’ and FORTRAN compilers as well as third party applications. Requests to install additional application software are welcomed and should be directed to

Ganglia Error: Embedded data could not be displayed.

[do_widget id=easy_sidebar_menu_widget-2] Creating a Login and connecting to the cluster All you need to do is request an account via Discovery’s account request form here: Discovery Account Request Most users interactively login to discovery.dartmouth.edu and submit jobs to be run

Check up on the status of Discovery and view usage information Status (off-site)

BLAST (Basic Local Alignment Search Tool) BLAST is one of the most commonly used search tools to perform a protein or nucleotide search of a single query sequence against a database of sequences. The BLAST algorithm works by finding a

Discovery is a Linux cluster comprised of: 85 16-Core (2x) Intel nodes (1360 cores) 18 24-Core (2x) Intel nodes (432 cores) 13 40 core (2x) Intel nodes (520 cores) 10 64 core (2x) AMD nodes (640 cores) In aggregate the

Name Position Parent Organization Phone William Hamblen Consulting Research Computing 6-1303 John Hudson Resource Manager Research Computing 6-0846 Susan Schwarz Applications and Education Research Computing 6-1458 The Discovery support team provides: General user support and training on cluster utilization. Systems

Home directories Your home directory on Discovery is physically on either the ZFS storage system or the Isilon parallel filesystem, and are available from all the compute nodes. Some users that are associated with members that have their own headnode

Overview The DISCOVERY Cluster is an exciting opportunity for researchers to participate in creating a world class super computer devoted to furthering research at Dartmouth. Researchers considering their own purchase of a Linux cluster are invited to consider the advantages

Discovery Overview Status Using Discovery Discovery Tutorials Blast Introduction

Application Description ADF ADF (Amsterdam Density Functional) is a Fortran program for calculations on atoms and molecules (in gas phase or solution). It can be used for the study of such diverse fields as molecular spectroscopy, organic and inorganic chemistry,

Debugger Description gdb You can use GDB to debug programs written in Fortran, Objective C, C and C++. GDB can do four main kinds of things (plus other things in support of these) to help you catch bugs in the

Using Modules to Manage Software The Discovery cluster uses modules to manage the user environment for different third-party software versions. The advantage of the modules approach is that the user is no longer required to explicitly specify paths for different

How to Select a Version of MPI There are two types of MPI, the message passing library, installed on the Discovery cluster. MPICH (MPICH2 and MPICH3) is used for message passing between compute nodes with an ethernet connection. MVAPICH (MVAPICH2)

Compilers There are C/C++ and FORTRAN compilers from different vendors including the Portland Group (PGI) and Intel installed on the cluster. Overall, they perform comparably on most codes. You may find that your codes compile more easily and/or get better

LIBRARY DESCRIPTION ACML The AMD Core Math Library (ACML) is a set of numerical routines tuned specifically for AMD64 platform processors. The routines, which are available via both FORTRAN and C interfaces, include: BLAS – Basic Linear Algebra Subprograms (including

Discovery has 12 GPU systems available to users; g01-g12. Each has two K80 GPU boards. Here is a sample submit script that will submit a job to run on the one of the GPU nodes. There are several applications and

How To Get Consistent Floating Point Results Using Intel Compilers Sometimes Discovery users find that their floating point C/C++/Fortran codes that were compiled with the Intel Compilers using -O2 and -O3 optimizations produce different results from one compiler version to

This cluster has 3 different kinds of compilers GNU Portland Group (PGI) Intel Below is table that shows the different compilers: LANGUAGE GNU COMMAND(S) PGI COMMAND INTEL COMMAND FILE SUFFIX Fortran 77 g77 pgf77 ifort .f .for .FOR ** .F

Here are some examples of how to read command line arguments with your program: C/C++: In a C/C++ program the declaration of the main function looks like this: int main ( int argc, char *argv[] ) The integer argc is

The BLAST program is run on the command line on Discovery. You must have an account on Discovery in order to use BLAST. Please contact the Research Computing group at Research.Computing@dartmouth.edu to obtain an account. The minimal requirements to run

On Discovery, we currently have the following databases available for BLAST searches. If you would like additional databases installed, please contact the Research Computing group at Research.Computing@dartmouth.edu DATABASE DESCRIPTION est Expressed sequence tag (EST) sequences from human, mouse, and others

There are many command line parameters that can be applied to a BLAST search to customize the results. Here are a few of the most commonly used parameters. For a complete listing please see the BLAST® Command Line Applications User

The basic format of a BLAST search: $ blastn -query il2.seq -db /idata/appdata/blastdb/refseq_rna -out il2.blastn To limit the number of one line descriptions and alignments that are shown (limited here to 10 each): $ blastn -query il2.seq -db /idata/appdata/blastdb/refseq_rna -num_descriptions

>gi|847817|gb|U25676.1|HSU25676 Human interleukin 2 (IL2) mRNA, complete cds ATCACTCTCTTTAATCACTACTCACATTAACCTCAACTCCTGCCACAATGTACAGGATGCAACTCCTGTC TTGCATTGCACTAATTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCGACAAAGAAAACAAAG AAAACACAGCTACAACTGGAGCATTTACTGCTGGATTTACAGATGATTTTGAATGGAATTAATAATTACA AGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACA GCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTGAATTTAGCTCAAAGCAAAAACTTT CACTTAAGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAA CATTCATGTGTGAATATGCAGATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTG TCAAAGCATCATCTCAACACTAACTTGATAATTAAGTGCTTCCCACTTAAAACATATCAGGCCTTCTATT TATTTATTTAAATATTTAAATTTTATATTTATTGTTGAATGTATGGTTGCTACCTATTGTAACTATTATT CTTAATCTTAAAACTATAAATATGGATCTTTTATGATTCTTTTTGTAAGCCCTAGGGGCTCTAAAATGGT TTACCTTATTTATCCCAAAAATATTTATTATTATGTTGAATGTTAAATATAGTATCTATGTAGATTGGTT AGTAAAACTATTTAATAAATTTGATAAATATAAAAAAAAAAAACAAAAAAAAAAA

LOCUS HSU25676 825 bp mRNA linear PRI 20-JUL-1995 DEFINITION Human interleukin 2 (IL2) mRNA, complete cds. ACCESSION U25676 VERSION U25676.1 GI:847817 KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates;

Research Computing staff John Wallace and Douglas Hill have been working with Classics professor Roberta Stewart to develop a tool at the nexus of scholarship, teaching and curation. Building on the excellent work by Diana Salsbury ’15 in association with

Below is a list of courses we regularly offer. Some of them may be available to take online at any time. Others are only available when we schedule them. Check our calendar to see what courses are currently scheduled. Request

Error: Embedded data could not be displayed.

http://www.ee.surrey.ac.uk/Teaching/Unix/

Here are the latest slides from the Introduction to Discovery course: [gview file=”http://rc.dartmouth.edu/wp-content/uploads/2019/04/Intro_to_Cluster.pdf”]

Research Computing values its partnerships with institutions and organizations across campus. Our current partners include: The Neukom Institute Bioinformatics at Geisel School of Medicine Computing @Thayer School of engineering Tuck Business School Research Computing Academic and Campus Technology Services (ACTS)

Statistics is a branch of mathematics dealing with the collection, analysis, interpretation, presentation, and organization of data. Statistics plays an important role in research, helping researchers extract meaning from their data. Statistics Research Guides Statistical Software Support Stata SAS SPSS

What courses would you like to take? – Request that we schedule one of our existing courses. Or if you don’t see what you are looking for on our courses page tell us about the course you wish we offered. Your

RStor – being phased out beginning 2017, replaced by DartFS RStor is Research Computing’s data storage offering. It is available to anyone in the Dartmouth community. RStor is based on the OpenAFS distributed filesystem which provides secure network file storage

Upcoming SWC ITC x Library Upcoming Events Software Carpentry – UNIX, GIT, and R Register here: https://libcal.dartmouth.edu/calendar/library/swc?hs=a 9:00am – 12:00pm 12/7/2021 – 12/10/2021 Software Carpentry workshop in Python for QBS (Plotting and Programming in Python) March 14-15, 20189, 9am –

This FAQ has moved to a new home in a Services Portal Knowledge Base article.

General Information Search the catalog of services on our client portal (services.dartmouth.edu) Getting Started With Research Computing Miscellaneous Program Areas and Application Support Geographic Information Systems (GIS) Life Science Informatics Math Applications High Performance Computing (HPC) Systems Discovery Cluster Python

Creating and hosting a variety of resources related to St. Paul’s Basilica in Rome including an AutoCAD model, historic architectural drawings, and curated walk-throughs.

DartFS – Your Next Generation Research Data Storage Solution

We are excited to announce a new service to Dartmouth researchers – DartFS, a next generation storage solution that will provide ample capacity and the ability to access your files in multiple ways from multiple devices. New users to DartFS [embedyt]

Research Computing is migrating accounts from Rstor/AFS to DartFS. People who have Discovery accounts as well as Rstor/AFS accounts will also be migrated during this time frame. The major changes that users will see from this migration are: You will

If you cannot find the answer to your request in our FAQs, please fill out the form below. [contact-form-7 id=”1400″ title=”Help Request”] * required fields

The purpose of the project is to identify the best way to color fluorescent images of a brain tumor during fluorescence-guided neurosurgery so a surgeon can identify and remove the tumor completely. We will use non-expert participants on Amazon Mechanical

[do_widget id=spacious_featured_single_page_widget-8] [do_widget id=spacious_featured_single_page_widget-2][do_widget id=spacious_featured_single_page_widget-3][do_widget id=spacious_featured_single_page_widget-4][do_widget id=spacious_featured_single_page_widget-5][do_widget id=spacious_featured_single_page_widget-6][do_widget id=spacious_featured_single_page_widget-7]

Programming N’ Pizza – PnP#14 Date: Wednesday, April 24, 2019 Time: 6pm – 8pm Location: Carson 61 Programming N’ Pizza – PnP#13 Date: Wednesday, February 20, 2019 Time: 5pm – 7pm Location: Carson 61 Programming N’ Pizza featuring IBM Aqua/Quantum computing – PnP#12 Date: Tuesday, January 22,

Informed by the findings of the 2013 Subcommittee of the Council on Computing and the 2015 HPC Taskforce, Research Computing, working with colleagues in Information, Technology & Consulting (ITC) is pleased to announce the new Dartmouth Research Computing (RC) Bill of

Subscribe to our mailing list * indicates required Email Address (@dartmouth.edu, if available) * First Name * Last Name * Department/School * Arts & SciencesThayerTuckGeiselTDIAdministration / IT&C / Librarynot affiliated Role * Undergraduate studentGraduate studentPostdoc / researcherFaculty / PIStaffOther Interests

Digital Humanities is a broad category of methods using quantitative or computational analysis to gain insight into cultural artifacts like text, images, and videos. .Services related to the digital humanities include: For a consultation or project planning related to the

Back to Main FAQ[xyz-ihs snippet=”openCloseFAQ”] [hrf_faqs category=’FaqStart’ title=’Getting Started with Research Computing’] [hrf_faqs category=’FaqMisc’ title=’Miscellaneous’]

Back to Main FAQ[xyz-ihs snippet=”openCloseFAQ”] [hrf_faqs category=’FaqDH’ title=’Digital Humanities’] [hrf_faqs category=’FaqGIS’ title=’Geographic Information Systems (GIS)’] [hrf_faqs category=’FaqLifeSci’ title=’Life Science Informatics’] [hrf_faqs category=’FaqMath’ title=’Math Applications’] [hrf_faqs category=’FaqProg’ title=’Programming and Parallel Programing’] [hrf_faqs category=’FaqStats’ title=’Statistics’] Back to Main FAQ[xyz-ihs snippet=”openCloseFAQ”]

Back to Main FAQ[xyz-ihs snippet=”openCloseFAQ”] [hrf_faqs category=’FaqHPCSys’ title=’Discovery Cluster’] [hrf_faqs category=’python’ title=’Python’] [hrf_faqs category=’FaqSMPSys’ title=’Shared Systems, Andes and Polaris’][hrf_faqs category=’FaqVirtSys’ title=’Virtual Machines and Cloud Systems’] Back to Main FAQ[xyz-ihs snippet=”openCloseFAQ”]

Back to Main FAQ[xyz-ihs snippet=”openCloseFAQ”] [hrf_faqs category=’FaqAFSMigration’ title=’AFS Migration’] [hrf_faqs category=’FaqDartfs’ title=’DartFS’] [hrf_faqs category=’FaqDataStor’ title=’Data Storage’] [hrf_faqs category=’FaqDB’ title=’Database Support’] Back to Main FAQ[xyz-ihs snippet=”openCloseFAQ”]

Content moved to https://services.dartmouth.edu/TDClient/1806/Portal/KB/ArticleDet?ID=140938

This is more information about DartFS permissions than most people will ever want to learn. We are happy to set up permissions for you if you do not choose to delve into this. Email us at Research.Computing@dartmouth.edu For those who

Services Research Computing at Dartmouth offers a wide range of computing services to the Dartmouth community to facilitate the advancement of research. We operate the supercomputer cluster at Dartmouth, allowing you to run compute intensive, large memory programs quickly. We

[siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] Training Research Computing helps you learn how to use research software and systems through our live training sessions and online classes. Browse the following calendar to lean more about the

[siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] High Performance Computing With a total of 3000+ CPU cores, 120,000 GPU cores, 12+TB of memory, and 1 PB of storage across all systems,

[siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] Research Computing provides reliable, high-speed network file storage to researchers at Dartmouth through DartFS. DartFS is a network-based storage service for documents and files. Your

[siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] Software Support We provide technical support and installation services for research software applications. Note: We offer support for research software, for help with non-research

[siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] Programming Support We develop, debug, and optimize code to effectively use resources and improve code performance, and help you collaborate with users to convert sequential

[siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] Life Science Informatics Life Sciences are the sciences concerned with the study of living organisms, including biology, botany, zoology, microbiology, physiology, biochemistry, and related

Geographic Information Systems Geographic Information Systems are systems to create, store, view, edit, analyze and export data that is tied to locations on the earth’s surface. Contact: Steve Gaughan, GIS Applications Specialist, stephen.p.gaughan@dartmouth.edu Services (see also examples toward the end

[siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] [siteorigin_widget class=”SiteOrigin_Widget_Button_Widget”][/siteorigin_widget] Discipline Specific Support Research Computing provides support to researchers across a wide spectrum of fields and disciplines. We have experts in fields including Physics,

This section contains information on requirements to receive DartFS storage, how to access DartFS once an account has been created for you, and how to access DartFS from off-campus.If you are accessing DartFS off-campus, you need to establish a VPN

In order to help you budget and work with us, whether it is for a grant or a project, the following pricing are in effect: DartFS – network attached data storage: DartFS comes in 2 performance tiers: Tier 3 –

Research Computing staff recently worked with Dr. Ruth Craig and James Adams of the Dartmouth College Library with data from the 1918 flu epidemic in support of her article “The mystery of a 1918 veteran and the flu pandemic” featured

The Biomedical Informatics Service Center provides the backbone computational tools, databases and domain expertise that facilitates modern biomedical, biological and genomic research. Our areas of focus are Cancer Registries (research), Clinical Trials and Prevention Studies and Genomics and Proteomics bioinformatics.

Download (PDF, 909KB) The Research, Teaching and Learning group in Information, Technology and Consulting (RTL@ITC) and the Neukom Institute have created an opportunity for new Dartmouth graduates to build development experience with virtual and augmented reality. This one-year, full-time, paid

To sing up for presentation please email to siva@dartmouth.edu Zoom session: We are meeting at https://here.dartmouth.edu. Click on the ‘table’ to join the zoom session. Future Presentations: We are working on our next

This is an example page. It’s different from a blog post because it will stay in one place and will show up in your site navigation (in most themes). Most people start with an About page that introduces them to

Choose a blok section

Our powerful Linux HPC cluster with GPU nodes and highspeed interconnects gives researchers the ability to work with a large volume of data and run complex, processing-intensive programs.

High Performance Computing Resources Our powerful Linux HPC cluster with GPU nodes and highspeed interconnects gives researchers the ability to work with a large volume of data and run complex, processing-intensive programs.

Research Computing offers a wide range of services from research software support to code development and grant support. Most of our services are available at no-cost to members of the Dartmouth research community including faculty, post-docs, graduate, and undergraduate students.

SERVICES – How we can help you: we consult and work to facilitate the use geospatial tools to support scholarship and research. We build publishable maps for research and presentation, convert street addresses to map locations on the earth’s surface

Mission: The Research Cyberinfrastructure team is here to support faculty, researchers, and students with their computing infrastructure and services needs. We aim to be responsive, flexible, and reliable. Requests: Email research.computing@dartmouth.edu with your requests. A ticket is create in our

The Data Experiences and Visualizations Studio is Research Computing’s emerging technologies group that supports all aspects of Dartmouth’s research, teaching, and learning mission. The DEV Studio’s main focus is currently on technologies that bridge the gap between the virtual and

At Research Software Engineering, we collaborate with researchers across disciplines to bridge the gap between innovative ideas and impactful outcomes. We do this by crafting efficient, sustainable software tools tailored to your specific research needs. From rapid prototypes and proof-of-concept